<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD with MathML3 v1.3 20210610//EN" "https://jats.nlm.nih.gov/publishing/1.3/JATS-journalpublishing1-3-mathml3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="Review Article" dtd-version="1.3" xml:lang="en">
  <front>
    <journal-meta>
      <journal-id journal-id-type="publisher-id">JVHC</journal-id>
      <journal-title-group>
        <journal-title>Journal of Veterinary Healthcare</journal-title>
      </journal-title-group>
      <issn pub-type="epub">2575-1212</issn>
      <publisher>
        <publisher-name>Open Access Pub</publisher-name>
        <publisher-loc>United States</publisher-loc>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.14302/issn.2575-1212.jvhc-23-4521</article-id>
      <article-id pub-id-type="publisher-id">JVHC-23-4521</article-id>
      <article-categories>
        <subj-group>
          <subject>Review Article</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>Detection of carbapenem resistance mechanisms among Avian Pathogenic <italic>Escherichia coli </italic>(APEC) isolated from broiler chickens</article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <name>
            <surname>Aya</surname>
            <given-names>El- shaer</given-names>
          </name>
          <xref ref-type="aff" rid="idm1839528980">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid">https://orcid.org/0000-0002-1381-8245</contrib-id><name>
            <surname>Amal</surname>
            <given-names>Awad</given-names>
          </name>
          <xref ref-type="aff" rid="idm1839528980">1</xref>
          <xref ref-type="aff" rid="idm1839525884">*</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid">https://orcid.org/0000-0002-3061-4076</contrib-id><name>
            <surname>Gamal</surname>
            <given-names>Younis</given-names>
          </name>
          <xref ref-type="aff" rid="idm1839528980">1</xref>
        </contrib>
      </contrib-group>
      <aff id="idm1839528980">
        <label>1</label>
        <addr-line>Department of Bacteriology, Mycology, and Immunology, Faculty of Veterinary Medicine, Mansoura University, Egypt.</addr-line>
      </aff>
      <aff id="idm1839525884">
        <label>*</label>
        <addr-line>Corresponding Author</addr-line>
      </aff>
      <contrib-group>
        <contrib contrib-type="editor">
          <name>
            <surname>Mohammed</surname>
            <given-names>A Elmetwally</given-names>
          </name>
          <xref ref-type="aff" rid="idm1839649572">1</xref>
        </contrib>
      </contrib-group>
      <aff id="idm1839649572">
        <label>1</label>
        <addr-line>Professor of Theriogenogy</addr-line>
      </aff>
      <author-notes>
        <corresp>
    
    Amal Awad, <addr-line>Department of Bacteriology, Mycology, and Immunology, Faculty of Veterinary Medicine, Mansoura University</addr-line>. <email>amalabdo@mans.edu.eg</email></corresp>
        <fn fn-type="conflict" id="idm1841608724">
          <p>The authors have declared that no competing interests exist.</p>
        </fn>
      </author-notes>
      <pub-date pub-type="epub" iso-8601-date="2023-05-09">
        <day>09</day>
        <month>05</month>
        <year>2023</year>
      </pub-date>
      <volume>3</volume>
      <issue>1</issue>
      <fpage>1</fpage>
      <lpage>13</lpage>
      <history>
        <date date-type="received">
          <day>14</day>
          <month>03</month>
          <year>2023</year>
        </date>
        <date date-type="accepted">
          <day>04</day>
          <month>04</month>
          <year>2023</year>
        </date>
        <date date-type="online">
          <day>09</day>
          <month>05</month>
          <year>2023</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>©</copyright-statement>
        <copyright-year>2023</copyright-year>
        <copyright-holder>Aya El- shaer, et al.</copyright-holder>
        <license xlink:href="http://creativecommons.org/licenses/by/4.0/" xlink:type="simple">
          <license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</license-p>
        </license>
      </permissions>
      <self-uri xlink:href="http://openaccesspub.org/jvhc/article/1962">This article is available from http://openaccesspub.org/jvhc/article/1962</self-uri>
      <abstract>
        <sec id="idm1839394236">
          <title>Background</title>
          <p>The emergence and spread of carbapenem-resistant gram-negative bacteria pose a serious threat to human health. Currently, little is known about the molecular mechanisms underlying carbapenem -resistance and their prevalence among APEC in Egypt. The aim of this study was to detect APEC in clinically diseased broiler chickens collected from broiler farms located at Dakahalia governorates, asses their virulence –associated genes, detect the antimicrobial   susceptibility of recovered isolates and to detect genes encoding carbapenemase resistant.</p>
        </sec>
        <sec id="idm1839391788">
          <title>Methods</title>
          <p>A total of 100 organ tissue samples were subjected to a conventional culture technique for isolation of E. coli. The confirmed E. coli were subjected to the disc diffusion method for detection of their susceptibility to antimicrobials. Polymerase chain reaction (PCR) was used for detection of APEC virulence genes (hlyA, iutA, ompT, iss, iroN) and six carbapenem- resistant genes namely, blaIMP, blaVIM, blaKPC, blaOXA-48, blaGES and blaNDM. </p>
        </sec>
        <sec id="idm1839392364">
          <title>Results</title>
          <p>Forty isolates were confirmed to be E. coli;  among them, three or more APEC virulence- genes were detected from all isolates. The hlyA gene was detected in 90% (36/40), iroN in 95% (38/40), ompT in 97.5% (39/40), iutA in 92.5% (35/40) and iss was detected in 95% (38/40) of APEC isolates. The tested isolates exhibited a remarkable resistance to ampicillin (97.5%), cefuroxime (92.5%), clindamycin (90%), chloramphenicol (62.5%), doxycycline (45%), amikacin (25%) and ciprofloxacin (12.5%), while the retrieved isolates displayed 100 % sensitivity against imipenem, meropenem, ertapenem, ceftazidime and colistin. Concerning carbapenemase-encoding genes, blaIMP, blaVIM, blaKPC, blaOXA-48, blaGES  couldn’t be detected among the E. coli isolates, while blaNDM was confirmed in three isolates. </p>
        </sec>
        <sec id="idm1839391644">
          <title>Conclusion</title>
          <p>The detection of NDM as one of the carbapenem resistant genes reveals that the resistant strains are not only capable of infecting humans, but that carbapenems- resistant E. coli  (CREC)  has also started to pose a threat to poultry farm and other livestock animals. This may give rise to worries that these food-carrying creatures could infect humans or colonize them. </p>
        </sec>
      </abstract>
      <kwd-group>
        <kwd>APEC</kwd>
        <kwd>carbapenemase-encoding genes</kwd>
        <kwd>virulence-associated genes broiler chicken</kwd>
        <kwd>antimicrobial susceptibility.</kwd>
      </kwd-group>
      <counts>
        <table-count count="3"/>
        <page-count count="13"/>
      </counts>
    </article-meta>
  </front>
  <body>
    <sec id="idm1839392076" sec-type="intro">
      <title>Introduction</title>
      <p>Although E. coli is thought to be a normal component of the microflora in the chicken intestine, some strains can spread to other internal organs and result in lethal disease known as colibacillosis <xref ref-type="bibr" rid="ridm1848537068">1</xref>. Colibacillosis causes huge economic losses in poultry farms. It is caused by one of the most prevalent extraintestinal pathogenic   (ExPEC), which cause infections outside of the gastrointestinal tract <xref ref-type="bibr" rid="ridm1848539516">2</xref> known as Avian Pathogenic E. coli (APEC) <xref ref-type="bibr" rid="ridm1848550612">3</xref><xref ref-type="bibr" rid="ridm1848408580">4</xref>.</p>
      <p>Multidrug resistance is a worrying problem that is being seen more frequently worldwide in both human and veterinary medicine <xref ref-type="bibr" rid="ridm1848407356">5</xref>. Although practically all therapeutically relevant antibiotics are generally ineffective against E. coli, this bacterium has a strong capacity to collect antibiotic resistance genes, primarily through horizontal gene transfer <xref ref-type="bibr" rid="ridm1848403252">6</xref>. </p>
      <p>Carbapenems are considered the last-line antibiotics for treatment of microbial infection in humans and they are commonly used to combat multiple resistant bacteria such as ESBL and MRSA which cannot be treated by other therapeutic options. However, there is concern that these carbapenemases will penetrate the food chain due to the recent discovery of this resistance in agricultural animals and poultry farms. Therefore, to maintain their effectiveness, the development and spread of resistance mechanisms against carbapenems have to be prevented. One benefit of this class of antibiotics is that carbapenems are comparatively resistant to hydrolysis by most β-lactamases. They are however inactivated by carbapenemases, which also confer resistance to β-lactams <xref ref-type="bibr" rid="ridm1848385404">7</xref>. The genes coding for carbapenemases are frequently located in mobile genetic elements, facilitating their dissemination horizontally among different bacteria <xref ref-type="bibr" rid="ridm1848388788">8</xref>.</p>
      <p>The appearance of carbapenemase-producing strains among gram-negative bacteria, particularly Enterobacteriaceae, has increased significantly over the past ten years, raising serious concerns and highlighting the need for prompt screening. Therefore, the aim of the present study was to detect presence of APEC in clinically diseased broiler chicken, detect the virulence-associated genes, investigate the antimicrobial susceptibility of recovered isolates and to identify the most common carbapenemase-encoding genes associated with the isolates under the study.</p>
    </sec>
    <sec id="idm1839391860" sec-type="materials">
      <title>Material and methods</title>
      <sec id="idm1839391428">
        <title>Sample collection</title>
        <p>One- hundred unhealthy broiler chickens grown on commercial farms were included in this study. The selected birds were collected from commercial farm located in Dakahlia province, Egypt and showed depression, a high mortality rate, low body weight and loss of appetite. On postmortem examination, the birds showed pericarditis, fibrinopurulent, aerosacculitis and perihepatitis. The samples were transported under cold conditions to the laboratory in the Department of Bacteriology, Mycology and Immunology, Faculty of Veterinary Medicine, Mansoura University. All samples were processed within 3 hours after collection.</p>
      </sec>
      <sec id="idm1839390132">
        <title>Isolation of Escherichia coli</title>
        <p>Chicken organ samples were directly enriched in MacConkey broth and incubated at 37°C for 18 hours. Then, a loopful from the overnight enriched broth culture was streaked onto Eosin Methylene Blue and MacConkey agar (Oxoid). The streaked plates were incubated at 37°C for 24 hours under aerobic conditions. Suspected colonies (pink colored colonies on MacConkey agar and green colonies with metallic shine on EMB) were picked and purified on tryptic soya agar plates (TSA) and stored for further identification. Preliminary identification of E. coli was performed based on Gram staining and the other standard biochemical examination <xref ref-type="bibr" rid="ridm1848374316">9</xref>.  </p>
      </sec>
      <sec id="idm1839389340">
        <title>Antimicrobial susceptibility testing  </title>
        <p>Tests were carried out by the disk diffusion method on Mueller–Hinton agar and the results were interpreted according to the clinical breakpoints recommended by the Clinical and Laboratory Standards Institute <xref ref-type="bibr" rid="ridm1848378708">10</xref>. The following antibiotic discs (Oxoid, UK) were used: ampicillin (AMP; 10 µg), amikacin (AK; 30µg), cefuroxime (CXM; 30 µg), Colistin sulfate (CT, 10 µg),  ceftazidime (CZN, 30 µg), imipenem (IPM, 10 μg), meropenem (MEM, 10 μg), ertapenem (ETP; 10 μg), ciprofloxacin (CIP; 5µg), clindamycin (DA; 2µg), chloramphenicol (C; 30µg ) and doxycycline (DO; 30µg). Isolates classified as “intermediate” were grouped with “resistant” isolates. If one strain displayed resistance to ≥ 3 antimicrobial classes, it was defined as MDR. </p>
      </sec>
      <sec id="idm1839389988">
        <title>Genomic DNA extraction  </title>
        <p>Genomic DNA was extracted  by boiling of  3-5 colonies of suspected isolates for 10 min in 100 μl of DNA/RNA free water followed by centrifuging at 13,000 rpm for 10 minutes. The supernatant from boiled lysate was used as DNA template. The concentration of the obtained DNA was tested using a Nanodrop (Nanodrop 1000, Thermo Scientific, UK) <xref ref-type="bibr" rid="ridm1848363692">11</xref>.</p>
      </sec>
      <sec id="idm1839389556">
        <title>Molecular characterization of E. coli </title>
        <p>The conventional PCR was used to confirm the suspected E. coli isolates using 16S rRNA. The confirmed E. coli isolates were then subjected to PCR for detection of 5 virulence-associated genes including hlyA, iutA, ompT, iss, iroN. The primer sets used for amplification were obtained from Invitrogen/USA <xref ref-type="table" rid="idm1841312404">Table 1</xref>. PCR reaction and cycling condition were performed as previously described <xref ref-type="bibr" rid="ridm1848362612">12</xref>. In brief, 12.5 μL master mix (BioLab Inc., New England), 1 μL of forward and reverse primer of 10 pmol, 5.5 μL nuclease free water and about 5 μL DNA template were added to form a final volume of 25μL. The following  thermal conditions were used: initial denaturation at  94 °C for 5 min,  35 cycles of 30 s at 94 °C, 1 min at 60 °C, and 1 min at 62 °C; the final extension was 72 °C for 5min. The PCR products were visualized by electrophoresis on 1.5% agarose gel in tris acetate buffer (TAE) and photographed. </p>
        <table-wrap id="idm1841312404">
          <label>Table 1.</label>
          <caption>
            <title> Oligonucleotide primers used in this study </title>
          </caption>
          <table rules="all" frame="box">
            <tbody>
              <tr>
                <td>Genes</td>
                <td>              Primer Sequence (5′–3′)</td>
                <td>Amplicons(bp)</td>
                <td>References</td>
              </tr>
              <tr>
                <td>
                  <italic>bla</italic>
                  <sub>OXA-48</sub>
                </td>
                <td>Forward: GCGTGGTTAAGGATGAACAC
Reverse: CATCAAGTTCAACCCAACCG</td>
                <td>438</td>
                <td>
                  <xref ref-type="bibr" rid="ridm1848367508">15</xref>
                </td>
              </tr>
              <tr>
                <td>
                  <italic>bla</italic>
                  <sub>IMP</sub>
                </td>
                <td>Foward:GGAATAGAGTGGCTTAAYTCTC Reverse: GGTTTAAYAAAACAACCACC</td>
                <td>232</td>
                <td>
                  <xref ref-type="bibr" rid="ridm1848367508">15</xref>
                </td>
              </tr>
              <tr>
                <td>
                  <italic>bla</italic>
                  <sub>GES</sub>
                </td>
                <td>Forward: AGTCGGCTAGACCGGAAAG Reverse: TTTGTCCGTGCTCAGGAT</td>
                <td>399</td>
                <td>
                  <xref ref-type="bibr" rid="ridm1848335396">17</xref>
                </td>
              </tr>
              <tr>
                <td>
                  <italic>bla</italic>
                  <sub>VIM</sub>
                </td>
                <td>Forward: GATGGTGTTTGGTCGCATAReverse: CGAATGCGCAGCACCAG</td>
                <td> 390</td>
                <td>
                  <xref ref-type="bibr" rid="ridm1848367508">15</xref>
                </td>
              </tr>
              <tr>
                <td>
                  <italic>bla</italic>
                  <sub>KPC</sub>
                </td>
                <td>Forward: CGTCTAGTTCTGCTGTCTTGReverse: CTTGTCATCCTTGTTAGGCG</td>
                <td> 798</td>
                <td>
                  <xref ref-type="bibr" rid="ridm1848367508">15</xref>
                </td>
              </tr>
              <tr>
                <td>
                  <italic>bla</italic>
                  <sub>NDM-1</sub>
                </td>
                <td>Forward :GGTTTGGCGATCTGGTTTTCReverse :CGGAATGGCTCATCACGATC</td>
                <td> 621</td>
                <td>
                  <xref ref-type="bibr" rid="ridm1848367508">15</xref>
                </td>
              </tr>
              <tr>
                <td>
                  <italic>16</italic>
                  <italic>S rRNA</italic>
                </td>
                <td>Foward :GACCTCGGTTTAGTTCACAGAReverse : CACACGCTGACGCTGACCA</td>
                <td>585 </td>
                <td>
                  <xref ref-type="bibr" rid="ridm1848346772">18</xref>
                </td>
              </tr>
              <tr>
                <td><italic>iut</italic>A</td>
                <td>F:GGCTGGACATCATGGGAACTGG
R: CGTCGGGAACGGGTAGAATCG</td>
                <td>302</td>
                <td>
                  <xref ref-type="bibr" rid="ridm1848344252">19</xref>
                </td>
              </tr>
              <tr>
                <td>
                  <italic>iss</italic>
                </td>
                <td>F:CAGCAACCCGAACCACTTGATG
R: AGCATTGCCAGAGCGGCAGAA</td>
                <td>323</td>
                <td>
                  <xref ref-type="bibr" rid="ridm1848344252">19</xref>
                </td>
              </tr>
              <tr>
                <td><italic>omp</italic>T</td>
                <td>F:TCATCCCGGAAGCCTCCCTCACTACTATR:TAGCGTTTGCTGCACTGGCTTCTGATAC</td>
                <td>496</td>
                <td>
                  <xref ref-type="bibr" rid="ridm1848344252">19</xref>
                </td>
              </tr>
              <tr>
                <td><italic>hly</italic>A</td>
                <td>F:GGCCACAGTCGTTTAGGGTGCTTACCR: GGCGGTTTAGGCATTCCGATACTCAG</td>
                <td>450</td>
                <td>
                  <xref ref-type="bibr" rid="ridm1848344252">19</xref>
                </td>
              </tr>
              <tr>
                <td>
                  <italic>iroN</italic>
                </td>
                <td>F:AATCCGGCAAAGAGACGAACCGCCTR:GTTCGGGCAACCCCTGCTTTGACTTT</td>
                <td>553</td>
                <td>
                  <xref ref-type="bibr" rid="ridm1848344252">19</xref>
                </td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
      </sec>
      <sec id="idm1839321420">
        <title>Detection of carbapenem-resistance genes </title>
        <p>Polymerase chain reaction (PCR) was performed to investigate the presence of carbapenemase-encoding genes, including blaKPC, blaNDM, blaVIM, blaIMP, blaGES and blaOXA-48 using PCR. The oligonucleotide primers (Invitrogen) are illustrated in <xref ref-type="table" rid="idm1841312404">Table 1</xref> as previously reported <xref ref-type="bibr" rid="ridm1848358364">13</xref><xref ref-type="bibr" rid="ridm1848354908">14</xref><xref ref-type="bibr" rid="ridm1848367508">15</xref><xref ref-type="bibr" rid="ridm1848339716">16</xref>. The reaction was performed as mentioned above using the following thermal condition described in <xref ref-type="table" rid="idm1841203916">Table 2</xref>.  PCR products were visualized in agarose gel electrophoresis using 1.5% agarose stained by ethidium bromide and photographed by the gel imaging system.</p>
        <table-wrap id="idm1841203916">
          <label>Table 2.</label>
          <caption>
            <title> Cyclic conditions used in PCR reactions.</title>
          </caption>
          <table rules="all" frame="box">
            <tbody>
              <tr>
                <td>Gene</td>
                <td>Primary denaturation</td>
                <td>Secondary denaturation</td>
                <td>Annealing</td>
                <td>Extension</td>
                <td>No. of cycles</td>
                <td>Final extension</td>
              </tr>
              <tr>
                <td>
                  <italic>16S rRNA</italic>
                </td>
                <td>94˚C3 min.</td>
                <td>94˚C30 sec.</td>
                <td>60˚C1 min.</td>
                <td>68˚C2 min..</td>
                <td>35</td>
                <td>72˚C10 min.</td>
              </tr>
              <tr>
                <td>
                  <italic>bla</italic>
                  <sub>NDM-1</sub>
                </td>
                <td>94˚C5 min.</td>
                <td>94˚C30 sec.</td>
                <td>55˚C30 sec.</td>
                <td>72˚C30 sec.</td>
                <td>35</td>
                <td>72˚C7 min.</td>
              </tr>
              <tr>
                <td>
                  <italic>bla</italic>
                  <sub>GES</sub>
                </td>
                <td>95 ˚C15min</td>
                <td>95 ˚C1 min</td>
                <td>59 ˚C1min</td>
                <td>72 ˚C5 min</td>
                <td>30</td>
                <td>72 ˚C</td>
              </tr>
              <tr>
                <td>
                  <italic>bla</italic>
                  <sub>OXA-48</sub>
                </td>
                <td>95 ˚C15 min</td>
                <td>95 ˚C1min</td>
                <td>60.5 ˚C1min</td>
                <td>72 ˚C5 min</td>
                <td>30</td>
                <td>72 ˚C</td>
              </tr>
              <tr>
                <td>
                  <italic>bla</italic>
                  <sub>IPM</sub>
                </td>
                <td>95 ˚C15 min</td>
                <td>95 ˚C1 min</td>
                <td>63 ˚C1 min</td>
                <td>72 ˚C5 min</td>
                <td>30</td>
                <td>72 ˚C</td>
              </tr>
              <tr>
                <td>
                  <italic>bla</italic>
                  <sub>VIM</sub>
                </td>
                <td>95 ˚C15 min</td>
                <td>95 ˚C1 min</td>
                <td>55 ˚C1 min</td>
                <td>72 ˚C5 min</td>
                <td>30</td>
                <td>72 ˚C</td>
              </tr>
              <tr>
                <td>
                  <italic>bla</italic>
                  <sub>KPC</sub>
                </td>
                <td>95 ˚C15 min</td>
                <td>95 ˚C1 min</td>
                <td>55 ˚C1 min</td>
                <td>72 ˚C5 min</td>
                <td>30</td>
                <td>72 ˚C</td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
        <p></p>
        <p></p>
        <p></p>
        <p></p>
        <p></p>
      </sec>
    </sec>
    <sec id="idm1839265116" sec-type="results">
      <title>Results</title>
      <sec id="idm1839265404">
        <title>Prevalence of E. coli in the tested samples </title>
        <p>Organ samples were collected from clinically diseased chicken and were initially subjected to traditional methods of E. coli isolation. Among them, 40 E. coli isolates were recovered based on microscopical and biochemical identification.  The suspected isolates were then confirmed by PCR assay targeting 16S rRNA (<xref ref-type="fig" rid="idm1841108932">Figure 1</xref>).  </p>
        <fig id="idm1841108932">
          <label>Figure 1.</label>
          <caption>
            <title> Agarose gel electrophoresis showing amplification of hly gene (450bp). Lane 1-6, 9, 10  positive samples. Lane 7, 8, 11-14: negative samples.</title>
          </caption>
          <graphic xlink:href="images/image1.jpg" mime-subtype="jpg"><alt-text>Figure 1. Agarose gel electrophoresis showing amplification of hly gene (450bp). Lane 1-6, 9, 10 positive samples.</alt-text></graphic>
        </fig>
      </sec>
      <sec id="idm1839261948">
        <title>Detection of carbapenemase encoding genes</title>
        <p>PCR was used to identify carbapenemase genes or metallo-β-lactamase genes. Out of six genes which were subjected to PCR, the NDM-1 gene was identified in 3 strains, while blaIMP, blaVIM, blaKPC, blaOXA-48 and blaGES couldn’t be detected. </p>
      </sec>
      <sec id="idm1839262884">
        <title>Distribution of virulence associated genes</title>
        <p>Virulence-associated genes were screened by PCR assay using specific primers. The selected virulence-associated genes were detected in high prevalence rates. The hlyA gene was detected in 90% (36/40), iroN in 95% (38/40), ompT in 97.5% (39/40), iutA in 92.5% (35/40) and iss was detected in 95% (38/40) of APEC isolates (<xref ref-type="fig" rid="idm1841106412">Figure 2</xref>, <xref ref-type="fig" rid="idm1841104828">Figure 3</xref>, <xref ref-type="fig" rid="idm1841102668">Figure 4</xref>, <xref ref-type="fig" rid="idm1841101660">Figure 5</xref>).</p>
        <fig id="idm1841106412">
          <label>Figure 2.</label>
          <caption>
            <title> Agarose gel electrophoresis showing amplification of hly gene (450bp). Lane 1-6, 9, 10  positive samples. Lane 7, 8, 11-14: negative samples.</title>
          </caption>
          <graphic xlink:href="images/image2.jpg" mime-subtype="jpg"><alt-text>Figure 2. Agarose gel electrophoresis showing amplification of hly gene (450bp). Lane 1-6, 9, 10 positive samples.</alt-text></graphic>
        </fig>
        <fig id="idm1841104828">
          <label>Figure 3.</label>
          <caption>
            <title> Agarose gel electrophoresis showing amplification of iroN gene (553bp). Lane 1-6, 8:  positive samples. Lane 7, 10-14: negative samples</title>
          </caption>
          <graphic xlink:href="images/image3.jpg" mime-subtype="jpg"><alt-text>Figure 3. Agarose gel electrophoresis showing amplification of iroN gene (553bp). Lane 1-6, 8: positive samples.</alt-text></graphic>
        </fig>
        <fig id="idm1841102668">
          <label>Figure 4.</label>
          <caption>
            <title> Agarose gel electrophoresis showing amplification of iutA gene (302bp). Lane 1-6:  positive samples. Lane 7: negative samples.</title>
          </caption>
          <graphic xlink:href="images/image4.jpg" mime-subtype="jpg"><alt-text>Figure 4. Agarose gel electrophoresis showing amplification of iutA gene (302bp). Lane 1-6: positive samples.</alt-text></graphic>
        </fig>
        <fig id="idm1841101660">
          <label>Figure 5.</label>
          <caption>
            <title> Agarose gel electrophoresis showing amplification of iss gene (323bp). Lane 1-6:  positive samples. Lane 7,8: negative samples.</title>
          </caption>
          <graphic xlink:href="images/image5.jpg" mime-subtype="jpg"><alt-text>Figure 5. Agarose gel electrophoresis showing amplification of iss gene (323bp). Lane 1-6: positive samples.</alt-text></graphic>
        </fig>
      </sec>
    </sec>
    <sec id="idm1839258636" sec-type="discussion">
      <title>Discussion</title>
      <p>Colibacillosis is a common infectious disease caused by APEC; since it results in significant financial losses for the poultry sector, this disease is a critical issue <xref ref-type="bibr" rid="ridm1848335396">17</xref>. This study aimed to detect APEC in broiler chicken symptomatic of colibacillosis as well as virulence-associated genes and carbapenem resistance genes among the retrieved APEC and to profile antimicrobial susceptibility in bacteria which are considered important work to recognize the pathogenesis and possible hazards of anti-microbial resistance of APEC. In this study, 100 diseased broiler chickens were collected from poultry farms and subjected to bacteriological examination; 40 (40%) E. coli isolates were recovered. Similarly, Hussein et al. <xref ref-type="bibr" rid="ridm1848346772">18</xref> could isolate E. coli with a similar infection rate (43.1%) out of 800 chickens, while Abd El Tawab et al. <xref ref-type="bibr" rid="ridm1848344252">19</xref> reported a prevalence rate of 44% from imported chicken and 75% from local broiler chickens. A higher detection rate (48%) was also recorded <xref ref-type="bibr" rid="ridm1848306820">20</xref>. On the other hand, a lower rate was detected previously <xref ref-type="bibr" rid="ridm1848302140">21</xref> with a frequency of 34.95%.  </p>
      <p>Presence of virulence factors in bacterial cells increases their capacity to cause disease. The present findings consequently extend and corroborate that numerous putative virulence genes engage in the pathogenesis of colibacillosis, since these genes were also discovered in colibacillosis isolates from various countries. It has been proposed that APEC retain these genes contributing to the development of colibacillosis. In this study, the virulence-associated genes selected were detected in high prevalence (90%, 95%, 97.5%, 92.5% and 95%) for hlyA, iroN, ompT, iut and iss respectively. The presence of these genes is associated with avian colibacillosis and indicates presence of APEC <xref ref-type="bibr" rid="ridm1848299188">22</xref>. The ompT may be involved in the pathogenesis of avian colibacillosis. It may also play a role in eukaryotic cell adhesion <xref ref-type="bibr" rid="ridm1848312436">23</xref>. In this study, the ompT gene was detected in high percentage (97.5%) which agrees with many previous reports detected this gene in high percentage among diseased chickens<xref ref-type="bibr" rid="ridm1848308548">24</xref><xref ref-type="bibr" rid="ridm1848268388">25</xref><xref ref-type="bibr" rid="ridm1848265364">26</xref><xref ref-type="bibr" rid="ridm1848260468">27</xref>recorded a lower detection rate of this gene. Throughout the infection, the ompT promotes the formation of bacterial populations. Thus, this higher frequency indicated its important role. APEC infection is indicated by its increased prevalence.  Regarding the iss gene, it is typically found on plasmids, produces a protein that contributes to serum resistance and complement resistance <xref ref-type="bibr" rid="ridm1848272780">28</xref>. Many previous reports could detect this gene in higher frequencies which point to the possibility that this gene may play a key role in the development of avian colibacillosis. In this study, the iss gene was identified in 95% of the retrieved E. coli isolates. Similarly, in Jordon, iss was identified in 93.3% of broiler chicken infected with colibacillosis <xref ref-type="bibr" rid="ridm1848242532">29</xref>.  In the United States, the iss gene was identified from 85.4% of APEC strains isolated from avian suffering from colibacillosis <xref ref-type="bibr" rid="ridm1848237276">30</xref>.  As well, the iss gene was identified in a high prevalence rate (86.9%) from E. coli isolated from chickens with colibacillosis in Iran <xref ref-type="bibr" rid="ridm1848233172">31</xref> . In this investigation, the frequency rate for the iutA gene was 92.5%. This outcome was consistent with a number of earlier international investigations as well <xref ref-type="bibr" rid="ridm1848229500">32</xref><xref ref-type="bibr" rid="ridm1848224820">33</xref>. However, Unno et al. <xref ref-type="bibr" rid="ridm1848224172">34</xref> observed a significantly lower frequency (49%). The iroN is also detected in a high percentage in E. coli isolates which support previous reports that it may be important in the etiology of avian colibacillosis <xref ref-type="bibr" rid="ridm1848221076">35</xref>. </p>
      <p>Infection with Carbapenem-Resistant Enterobacteriaceae (CRE) is emerging as an important challenge in health-care settings and a growing concern worldwide <xref ref-type="bibr" rid="ridm1848247932">36</xref><xref ref-type="bibr" rid="ridm1848211484">37</xref>. The incidence of carbapenem resistance in bacteria from animals hasn't received much attention, despite the fact that carbapenemases have been identified as a novel and perhaps developing concern in food-producing animals <xref ref-type="bibr" rid="ridm1848208172">38</xref>. The majority of epidemiological research to date has concentrated on human studies, with little work being done on animals used as food. In this study, a PCR was used for screening the retrieved E. coli isolates  for the presence of carbapenem resistant genes. Among them, the NDM was identified in three isolates (7.5%; 3/40). Recently, a significant high frequency of NDM-1 has been also reported in China and India <xref ref-type="bibr" rid="ridm1848204788">39</xref><xref ref-type="bibr" rid="ridm1848200252">40</xref>. Additionally, a high prevalence rate of blaNDM (80%) was previously reported <xref ref-type="bibr" rid="ridm1848196436">41</xref>. The NDM was first discovered in Sweden in a patient who contracted an infection while travelling in India <xref ref-type="bibr" rid="ridm1848192620">42</xref>. Since then, the rapid spread of isolates that produce NDM via —MDR plasmids occurs raising the possibility that the widespread illnesses brought on by these strains will soon become incurable <xref ref-type="bibr" rid="ridm1848189740">43</xref>.  Due to the widespread usage of antibiotics and the resulting high selection pressure, novel NDM-1 variants are emerging in India. Antibiotics for Gram-negative bacteria are scarce, and none of them are effective against NDM-1 producers <xref ref-type="bibr" rid="ridm1848186716">44</xref>. Other carbapenemase genes including blaIMP, blaVIM, blaKPC and blaOXA-48 were not detected in this study. Although carbapenems are rarely used to in food, it's possible that the CREC evolved concurrently with resistance to other antimicrobials <xref ref-type="bibr" rid="ridm1848183692">45</xref>. The development of carbapenem resistance has been suggested that coselection of carbapenemase genes under the selection pressure imposed by the use of aminopenicillins and aminopenicillin—lactamase inhibitor combinations in farm animals <xref ref-type="bibr" rid="ridm1848142116">46</xref></p>
      <p>All obtained E. coli isolates were subjected to an antimicrobial susceptibility test. In this study the highest resistance was recorded against ampicillin (97.5%), cefuroxime (92.5%), clindamycin (90%) and chloramphenicol (62.5%), while 100% sensitivity was recorded against imipenem, meropenem and colistin and 87.5% to ciprofloxacin, 75% to amikacin and 55% to doxycycline. Dissimilar to this study, Kumarasamy et al. <xref ref-type="bibr" rid="ridm1848200252">40</xref> reported complete resistance to meropenem and imipenem, while Ho et al. <xref ref-type="bibr" rid="ridm1848137436">47</xref> reported resistance rates of 98.9 % (91/92), 91.3 % (84/92) and 95.7 % (88/92) to ‏ertapenem, imipenem and meropenem. Similarly, in another study <xref ref-type="bibr" rid="ridm1848385404">7</xref> ‏ E. coli isolates were resistant to ampicillin, cefotaxime, ceftazidime, cefepime, cefoxitin, ciprofloxacin, gentamicin, nalidixic acid, sulphamethoxazole, trimethoprim, meropenem, ertapenem, imipenem and, but a higher sensitivity was recorded  against azithromycin, colistin and tetracycline <xref ref-type="bibr" rid="ridm1848135852">48</xref>. Carbapenem-resistant E. coli isolates were identified with carbapenems (including imipenem, meropenem, and ertapenem), MICs ranging from 2 μg/mL to ≧ 16 μg/mL <xref ref-type="bibr" rid="ridm1848132396">49</xref>. E. coli isolates were found to be resistant to imipenem and meropenem but lower resistance was found in Hong Kong <xref ref-type="bibr" rid="ridm1848129012">50</xref><xref ref-type="bibr" rid="ridm1848126924">51</xref><xref ref-type="bibr" rid="ridm1848121956">52</xref> in which carbapenem non-susceptible among clinical E. coli isolates remains rare and limited to sporadic occurrence. </p>
    </sec>
    <sec id="idm1839257412" sec-type="conclusions">
      <title>Conclusion</title>
      <p>Detection of carbapenem resistance genes, virulence-associated genes among APEC and profiling antimicrobial susceptibility in bacteria have been considered as important work to recognize the pathogenesis and possible hazards of anti-microbial resistance of APEC. Colibacillosis can be prevented and controlled using antibiotics to treat the bacterial infections and to eliminate some predisposing causes. Therefore, restriction in antimicrobial use in poultry farms among veterinarians is highly recommended to control the spread of antimicrobial-resistant bacteria among poultry farms.</p>
    </sec>
  </body>
  <back>
    <ref-list>
      <ref id="ridm1848537068">
        <label>1.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Ragione</surname>
            <given-names>La</given-names>
          </name>
          <name>
            <surname>R</surname>
            <given-names>M Woodward</given-names>
          </name>
          <name>
            <surname>J</surname>
            <given-names>M</given-names>
          </name>
          <article-title>Virulence factors of Escherichia coli serotypes associated with avian colisepticemia</article-title>
          <source>Res. Vet. Sci</source>
          <chapter-title>Avian Colibacillosis and Salmonellosis: A Closer Look at Epidemiology, Pathogenesis, Diagnosis, Control and Public Health Concerns</chapter-title>
          <volume>2002</volume>
          <fpage>27</fpage>
          <lpage>35</lpage>
        <pub-id pub-id-type="doi">10.1016/s0034-5288(02)00075-9</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848539516">
        <label>2.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>C</surname>
            <given-names>D Köhler</given-names>
          </name>
          <name>
            <surname>Dobrindt</surname>
            <given-names>U</given-names>
          </name>
          <article-title>What defines extraintestinal pathogenic Escherichia coli?</article-title>
          <date>
            <year>2011</year>
          </date>
          <source>International Journal of Medical Microbiology</source>
          <volume>301</volume>
          <issue>8</issue>
          <fpage>642</fpage>
          <lpage>647</lpage>
        <pub-id pub-id-type="doi">10.1016/j.ijmm.2011.09.006</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848550612">
        <label>3.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>L</surname>
            <given-names>C Crossman</given-names>
          </name>
          <name>
            <surname>R</surname>
            <given-names/>
          </name>
          <name>
            <surname>S</surname>
            <given-names>A Beatson</given-names>
          </name>
          <name>
            <surname>T</surname>
            <given-names>J Wells</given-names>
          </name>
          <name>
            <surname>Desvaux</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names>F Cunningham</given-names>
          </name>
          <article-title>A commensal gone bad: complete genome sequence of the prototypical enterotoxigenic Escherichia coli strain H10407</article-title>
          <date>
            <year>2010</year>
          </date>
          <source>Journal of bacteriology</source>
          <volume>192</volume>
          <issue>21</issue>
          <fpage>5822</fpage>
          <lpage>5831</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848408580">
        <label>4.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>M</surname>
            <given-names>A Croxen</given-names>
          </name>
          <name>
            <surname>B</surname>
            <given-names/>
          </name>
          <article-title>Molecular mechanisms of Escherichia coli pathogenicity</article-title>
          <date>
            <year>2010</year>
          </date>
          <source>Nature Reviews Microbiology</source>
          <volume>8</volume>
          <issue>1</issue>
          <fpage>26</fpage>
          <lpage>38</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848407356">
        <label>5.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Allocati</surname>
            <given-names>N</given-names>
          </name>
          <name>
            <surname>Masulli</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>F Alexeyev</given-names>
          </name>
          <name>
            <surname>C</surname>
            <given-names>Di Ilio</given-names>
          </name>
          <article-title>Escherichia coli in Europe: an overview</article-title><source>International journal of environmental research and public health</source><date>
            <year>2013</year>
          </date>
          <volume>10</volume>
          <issue>12</issue>
          <fpage>6235</fpage>
          <lpage>6254</lpage>
        <pub-id pub-id-type="doi">10.3390/ijerph10126235</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848403252">
        <label>6.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Snyman</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Whitelaw</surname>
            <given-names>A C</given-names>
          </name>
          <name>
            <surname>Reuter</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>MRB</surname>
            <given-names>Maloba</given-names>
          </name>
          <name>
            <surname>Newton-Foot</surname>
            <given-names>M</given-names>
          </name>
          <article-title>Colistin resistance mechanisms in clinical Escherichia coli and Klebsiella spp. Isolates from the Western Cape of South Africa</article-title><source>Microb Drug Resist</source><volume>27</volume>
          <issue>9</issue>
          <fpage>1249</fpage>
          <lpage>1258</lpage>
          <pub-id pub-id-type="doi">10.1089/mdr.2020.0479</pub-id>
        </mixed-citation>
      </ref>
      <ref id="ridm1848385404">
        <label>7.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Garcia-Graells</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Berbers</surname>
            <given-names>B</given-names>
          </name>
          <name>
            <surname>Verhaegen</surname>
            <given-names>B</given-names>
          </name>
          <name>
            <surname>Vanneste</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Marchal</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>N</surname>
            <given-names>H Roosens</given-names>
          </name>
          <article-title>First detection of a plasmid located carbapenem resistant blaVIM-1 gene in isolated from meat products at retail in Belgium in 2015. International journal of food microbiology</article-title>
          <date>
            <year>2020</year>
          </date>
          <fpage>324</fpage>
          <lpage>108624</lpage>
        <pub-id pub-id-type="doi">10.1016/j.ijfoodmicro.2020.108624</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848388788">
        <label>8.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Monteiro</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>R</surname>
            <given-names>H Widen</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names>C Pignatari</given-names>
          </name>
          <name>
            <surname>Kubasek</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Silbert</surname>
            <given-names>S</given-names>
          </name>
          <article-title>Rapid detection of carbapenemase genes by multiplex real-time PCR</article-title>
          <date>
            <year>2012</year>
          </date>
          <source>Journal of Antimicrobial Chemotherapy</source>
          <volume>67</volume>
          <issue>4</issue>
          <fpage>906</fpage>
          <lpage>909</lpage>
        <pub-id pub-id-type="doi">10.1093/jac/dkr563</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848374316">
        <label>9.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Quinn</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Markey</surname>
            <given-names>B</given-names>
          </name>
          <name>
            <surname>Carter</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Donnelly</surname>
            <given-names>W</given-names>
          </name>
          <name>
            <surname>Leonard</surname>
            <given-names>F</given-names>
          </name>
          <date>
            <year>2002</year>
          </date>
          <institution>Veterinary Microbiology and Microbial Disease; Blackwell Science Company: Hoboken, NJ, USA; State University Press:</institution>
          <publisher-loc>Detroit, MI, USA</publisher-loc>
        </mixed-citation>
      </ref>
      <ref id="ridm1848378708">
        <label>10.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Clinical</surname>
            <given-names/>
          </name>
          <article-title>Laboratory Standards Institute.2018. Performance standards for antimicrobial susceptibility testing. Twenty eight international supplement. Clinical and Laboratory Standards</article-title>
        </mixed-citation>
      </ref>
      <ref id="ridm1848363692">
        <label>11.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Ramadan</surname>
            <given-names>H</given-names>
          </name>
          <name>
            <surname>Awad</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Ateya</surname>
            <given-names>A</given-names>
          </name>
          <article-title>Detection of phenotypes, virulence genes and phylotypes of avian pathogenic and human diarrheagenic Escherichia coli in Egypt</article-title>
          <date>
            <year>2016</year>
          </date>
          <source>The Journal of Infection in Developing Countries</source>
          <volume>10</volume>
          <issue>06</issue>
          <fpage>584</fpage>
          <lpage>591</lpage>
        <pub-id pub-id-type="doi">10.3855/jidc.7762</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848362612">
        <label>12.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Amit-Romach</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>Sklan</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Uni</surname>
            <given-names>Z</given-names>
          </name>
          <article-title>Microflora ecology of the chicken intestine using 16S ribosomal DNA primers</article-title><source>Poultry science</source><date>
            <year>2004</year>
          </date>
          <fpage>83</fpage>
          <lpage>7</lpage>
        <pub-id pub-id-type="doi">10.1093/ps/83.7.1093</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848358364">
        <label>13.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Mammeri</surname>
            <given-names>H</given-names>
          </name>
          <name>
            <surname>Guillon</surname>
            <given-names>H</given-names>
          </name>
          <name>
            <surname>Eb</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>Nordmann</surname>
            <given-names>P</given-names>
          </name>
          <article-title>Phenotypic and biochemical comparison of the carbapenem-hydrolyzing activities of five plasmid-borne AmpC β-lactamases</article-title><source>Antimicrobial agents and chemotherapy</source><date>
            <year>2010</year>
          </date>
          <volume>54</volume>
          <issue>11</issue>
          <fpage>4556</fpage>
          <lpage>4560</lpage>
        <pub-id pub-id-type="doi">10.1128/aac.01762-09</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848354908">
        <label>14.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Bokaeian</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Shahraki</surname>
            <given-names>Zahedani S</given-names>
          </name>
          <name>
            <surname>Soltanian</surname>
            <given-names>Bajgiran M</given-names>
          </name>
          <name>
            <surname>Ansari</surname>
            <given-names>Moghaddam A</given-names>
          </name>
          <article-title>Frequency of PER, VEB, SHV, TEM and CTX-M genes in resistant strains of Pseudomonas aeruginosa producing extended spectrum beta-lactamases</article-title>
          <date>
            <year>2015</year>
          </date>
          <source>Jundishapur J. Microbiol</source>
          <volume>8</volume>
          <fpage>10</fpage>
          <lpage>5812</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848367508">
        <label>15.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>E</surname>
            <given-names>D Candan</given-names>
          </name>
          <name>
            <surname>Aksoz</surname>
            <given-names>N</given-names>
          </name>
          <article-title>Klebsiella pneumoniae:characteristics of carbapenem resistance and virulence factors</article-title>
          <date>
            <year>2015</year>
          </date>
          <source>Acta Biochim. Pol</source>
          <volume>62</volume>
          <fpage>867</fpage>
          <lpage>874</lpage>
        <pub-id pub-id-type="doi">10.18388/abp.2015_1148</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848339716">
        <label>16.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Sugawara</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>Kojima</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Nikaido</surname>
            <given-names>H</given-names>
          </name>
          <date>
            <year>2016</year>
          </date>
          <chapter-title>Klebsiella pneumoniae Major Porins OmpK35 and OmpK36 allow more efficient diffusion of beta-lactams than their Escherichia coli homologs OmpF</chapter-title>
          <volume>198</volume>
          <fpage>10</fpage>
          <lpage>1128</lpage>
        <pub-id pub-id-type="doi">10.1128/jb.00590-16</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848335396">
        <label>17.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Dallenne</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Costa</surname>
            <given-names>Da</given-names>
          </name>
          <name>
            <surname>Decré</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Favier</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>C</surname>
            <given-names/>
          </name>
          <name>
            <surname>Arlet</surname>
            <given-names>G</given-names>
          </name>
          <article-title>Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae</article-title>
          <date>
            <year>2010</year>
          </date>
          <source>Journal of Antimicrobial Chemotherapy</source>
          <volume>65</volume>
          <issue>3</issue>
          <fpage>490</fpage>
          <lpage>495</lpage>
        <pub-id pub-id-type="doi">10.1093/jac/dkp498</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848346772">
        <label>18.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Amit-Romach</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>Sklan</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Uni</surname>
            <given-names>Z</given-names>
          </name>
          <article-title>Microflora ecology of the chicken intestine using 16S ribosomal DNA primers</article-title><source>Poultry science</source><date>
            <year>2004</year>
          </date>
          <volume>83</volume>
          <issue>7</issue>
          <fpage>1093</fpage>
          <lpage>8</lpage>
        <pub-id pub-id-type="doi">10.1093/ps/83.7.1093</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848344252">
        <label>19.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Ewers</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Janßen</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>Kießling</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>H</surname>
            <given-names>C Philipp</given-names>
          </name>
          <name>
            <surname>L</surname>
            <given-names>H Wieler</given-names>
          </name>
          <article-title>Rapid detection of virulence-associated genes in avian pathogenic Escherichia coli by multiplex polymerase chain reaction</article-title><source>Avian diseases</source><date>
            <year>2005</year>
          </date>
          <volume>49</volume>
          <issue>2</issue>
          <fpage>269</fpage>
          <lpage>273</lpage>
        <pub-id pub-id-type="doi">10.1637/7293-102604r</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848306820">
        <label>20.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Chansiripornchai</surname>
            <given-names>N</given-names>
          </name>
          <article-title>Comparative efficacy of enrofloxacin and oxytetracycline by different administration methods in broilers after experimental infection with avian pathogenic Escherichia coli</article-title>
          <date>
            <year>2009</year>
          </date>
          <source>The Thai Journal of Veterinary Medicine</source>
          <volume>39</volume>
          <issue>3</issue>
          <fpage>231</fpage>
          <lpage>236</lpage>
        <pub-id pub-id-type="doi">10.56808/2985-1130.2178</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848302140">
        <label>21.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Hussein</surname>
            <given-names>H</given-names>
          </name>
          <name>
            <surname>Barakat</surname>
            <given-names>H</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names/>
          </name>
          <name>
            <surname>Shoukry</surname>
            <given-names>N</given-names>
          </name>
          <article-title>Endotoxin production from Escherichia coli O157 locally isolated from some Egyptian foods and its effect on liver efficiency in rats</article-title>
          <date>
            <year>2017</year>
          </date>
          <source>Journal of Environmental Science</source>
          <volume>40</volume>
          <issue>3</issue>
          <fpage>23</fpage>
          <lpage>36</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848299188">
        <label>22.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Abd</surname>
            <given-names>El Tawab</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names/>
          </name>
          <name>
            <surname>F</surname>
            <given-names>I El-Hofy</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>E El-khayat</given-names>
          </name>
          <name>
            <surname>H</surname>
            <given-names>B Mahmoud</given-names>
          </name>
          <article-title>Prevalence of blaTEM and blaSHV genes in genomic and plasmid DNA of ESBL producing Escherichia coli clinical isolates from chicken</article-title>
          <date>
            <year>2016</year>
          </date>
          <source>Benha Veterinary Medical Journal</source>
          <volume>31</volume>
          <issue>1</issue>
          <fpage>167</fpage>
          <lpage>177</lpage>
        <pub-id pub-id-type="doi">10.21608/bvmj.2016.31245</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848312436">
        <label>23.</label>
        <mixed-citation xlink:type="simple" publication-type="journal"><name><surname>Kilic</surname><given-names>A</given-names></name><name><surname>Muz</surname><given-names>A</given-names></name><name><surname>H</surname><given-names>B Ertas</given-names></name><name><surname>Ozbey</surname><given-names>G</given-names></name><date><year>2009</year></date>
Random amplified polymorphic



</mixed-citation>
      </ref>
      <ref id="ridm1848308548">
        <label>24.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Momtaz</surname>
            <given-names>H</given-names>
          </name>
          <name>
            <surname>Jamshidi</surname>
            <given-names>A</given-names>
          </name>
          <article-title>Shiga toxin-producing Escherichia coli isolated from chicken meat in Iran: Serogroups, virulence factors, and antimicrobial resistance properties</article-title>
          <date>
            <year>2013</year>
          </date>
          <source>Poultry science</source>
          <volume>92</volume>
          <issue>5</issue>
          <fpage>1305</fpage>
          <lpage>1313</lpage>
        <pub-id pub-id-type="doi">10.3382/ps.2012-02542</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848268388">
        <label>25.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Timothy</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Shafi</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Leatherbarrow</surname>
            <given-names>A H</given-names>
          </name>
          <name>
            <surname>FTW</surname>
            <given-names>Jordan</given-names>
          </name>
          <name>
            <surname>Wigley</surname>
            <given-names>P</given-names>
          </name>
          <article-title>Molecular epidemiology of a reproductive tract associated colibacillosis outbreak in a layer breeder flock associated with atypical avian pathogenic Escherichia coli</article-title>
          <source>Avian Pathol</source>
          <volume>37</volume>
          <issue>4</issue>
          <fpage>375</fpage>
          <lpage>8</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848265364">
        <label>26.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>H</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Zhu</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Ma</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Zhang</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Pan</surname>
            <given-names>Z</given-names>
          </name>
          <name>
            <surname>Zhang</surname>
            <given-names>W</given-names>
          </name>
          <name>
            <surname>Yao</surname>
            <given-names>H</given-names>
          </name>
          <article-title>Functional role of ompF and ompC porins in pathogenesis of avian pathogenic Escherichia coli</article-title>
          <date>
            <year>2017</year>
          </date>
          <source>Microbial pathogenesis</source>
          <volume>107</volume>
          <fpage>29</fpage>
          <lpage>37</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848260468">
        <label>27.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>de</surname>
            <given-names>Oliveira AL</given-names>
          </name>
          <name>
            <surname>Rocha</surname>
            <given-names>D A</given-names>
          </name>
          <name>
            <surname>Finkler</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>de</surname>
            <given-names>Moraes LB</given-names>
          </name>
          <name>
            <surname>Barbieri</surname>
            <given-names>N L</given-names>
          </name>
          <name>
            <surname>Pavanelo</surname>
            <given-names>D B</given-names>
          </name>
          <name>
            <surname>Winkler</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Grassotti</surname>
            <given-names>T T</given-names>
          </name>
          <name>
            <surname>de</surname>
            <given-names>Brito KCT</given-names>
          </name>
          <name>
            <surname>de</surname>
            <given-names>Brito BG</given-names>
          </name>
          <name>
            <surname>Horn</surname>
            <given-names>F</given-names>
          </name>
          <date>
            <year>2015</year>
          </date>
          <chapter-title>Prevalence of ColV Plasmid- Linked Genes and In Vivo Pathogenicity of Avian Strains of Escherichia coli, Foodborne Path Dis:</chapter-title>
          <volume>12</volume>
          <fpage>679</fpage>
          <lpage>684</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848272780">
        <label>28.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Chalmers</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names>C Cormier</given-names>
          </name>
          <name>
            <surname>Nadeau</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Côté</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>R</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Boerlin</surname>
            <given-names>P</given-names>
          </name>
          <article-title>Determinants of virulence and of resistance to ceftiofur, gentamicin, and spectinomycin in clinical Escherichia coli from broiler chickens in</article-title>
          <date>
            <year>2017</year>
          </date>
          <fpage>203</fpage>
          <lpage>149</lpage>
          <publisher-name>Veterinary microbiology</publisher-name>
          <publisher-loc>Québec, Canada</publisher-loc>
        <pub-id pub-id-type="doi">10.1016/j.vetmic.2017.02.005</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848242532">
        <label>29.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Varga</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Brash</surname>
            <given-names>M L</given-names>
          </name>
          <name>
            <surname>Slavic</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Boerlin</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Ouckama</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Weis</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Petrik</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Philippe</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Barham</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Guerin</surname>
            <given-names>M T</given-names>
          </name>
          <article-title>Evaluating virulence-associatedg and antimicrobial resistance of avian pathogenic Escherichia coli isolates from droiler and broiler Breeder chickens in Ontario</article-title>
          <date>
            <year>2018</year>
          </date>
          <source>Canada. Avian Dis</source>
          <volume>62</volume>
          <fpage>291</fpage>
          <lpage>299</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848237276">
        <label>30.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Mbanga</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Nyararai</surname>
            <given-names>Y O</given-names>
          </name>
          <article-title>Virulence gene profiles of avian pathogenic Escherichia coli isolated from chickens with colibacillosis in Bulawayo, Zimbabwe</article-title>
          <date>
            <year>2015</year>
          </date>
          <source>Onderstepoort J Vet Res</source>
          <volume>82</volume>
          <issue>1</issue>
          <fpage>850</fpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848233172">
        <label>31.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Binns</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Davies</surname>
            <given-names>D L</given-names>
          </name>
          <name>
            <surname>Hardy</surname>
            <given-names>K G</given-names>
          </name>
          <article-title>Cloned fragments of the plasmid ColV, I-K94 specifying virulence and serum resistance</article-title>
          <date>
            <year>1979</year>
          </date>
          <source>Nature</source>
          <volume>279</volume>
          <issue>5716</issue>
          <fpage>778</fpage>
          <lpage>781</lpage>
        <pub-id pub-id-type="doi">10.1038/279778a0</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848229500">
        <label>32.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>R</surname>
            <given-names>A Ibrahim</given-names>
          </name>
          <name>
            <surname>T</surname>
            <given-names>L Cryer</given-names>
          </name>
          <name>
            <surname>S</surname>
            <given-names>Q Lafi</given-names>
          </name>
          <article-title>Identification of Escherichia coli from broiler chickens in Jordan, their antimicrobial resistance, gene characterization and the associated risk factors</article-title>
          <date>
            <year>2019</year>
          </date>
          <source>BMC Vet Res</source>
          <volume>15</volume>
          <fpage>159</fpage>
        <pub-id pub-id-type="doi">10.1186/s12917-019-1901-1</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848224820">
        <label>33.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Dissanayake</surname>
            <given-names>D R</given-names>
          </name>
          <name>
            <surname>Octavia</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Lan</surname>
            <given-names>R</given-names>
          </name>
          <article-title>Population structure and virulence content of avian pathogenic Escherichia coli isolated from outbreaks in Sri Lanka</article-title>
          <date>
            <year>2014</year>
          </date>
          <source>Vet Microbiol</source>
          <volume>168</volume>
          <fpage>403</fpage>
          <lpage>412</lpage>
        <pub-id pub-id-type="doi">10.1016/j.vetmic.2013.11.028</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848224172">
        <label>34.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Bonjar</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Salari</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Jahantigh</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Rashki</surname>
            <given-names>A</given-names>
          </name>
          <article-title>Frequency of iss and irp2 genes by PCR method in Escherichia coli isolated from poultry with colibacillosis in comparison with healthy chicken in poultry farms of Zabol, South East of Iran. Polish journal of veterinary sciences</article-title>
          <date>
            <year>2017</year>
          </date>
        </mixed-citation>
      </ref>
      <ref id="ridm1848221076">
        <label>35.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Schouler</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Schaeffer</surname>
            <given-names>B</given-names>
          </name>
          <name>
            <surname>Bree</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Mora</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Dahbi</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>Biet</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>Oswald</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>Mainil</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Blanco</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Moulin-Schouleur</surname>
            <given-names>M</given-names>
          </name>
          <article-title>Diagnostic strategy for identifying avian pathogenic Escherichia coli based on fourpatterns of virulence genes</article-title>
          <date>
            <year>2012</year>
          </date>
          <source>J Clin Microb</source>
          <volume>50</volume>
          <fpage>1673</fpage>
          <lpage>1678</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848247932">
        <label>36.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Mohamed</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Ge</surname>
            <given-names>Z</given-names>
          </name>
          <name>
            <surname>Yuehua</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Yubin</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>Rachid</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Mustapha</surname>
            <given-names>O</given-names>
          </name>
          <name>
            <surname>Junwei</surname>
            <given-names>W</given-names>
          </name>
          <name>
            <surname>Karine</surname>
            <given-names>O</given-names>
          </name>
          <article-title>Virulence traits of avian pathogenic (APEC) and fecal (AFEC)</article-title>
        </mixed-citation>
      </ref>
      <ref id="ridm1848211484">
        <label>37.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <article-title>E. coli isolated from broiler chickens in Algeria. Tropical animal health and productionMar;50(3):</article-title>
          <fpage>547</fpage>
          <lpage>53</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848208172">
        <label>38.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Unno</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>Han</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Jang</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Widmer</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Ko</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>J Sadowsky</given-names>
          </name>
          <name>
            <surname>H</surname>
            <given-names>G</given-names>
          </name>
          <article-title>Genotypic and phenotypic trends in antibiotic resistant pathogenic Escherichia coli isolated from humans and farm animals in South Korea</article-title><source>Microbes and environments</source><date>
            <year>2011</year>
          </date>
          <volume>26</volume>
          <issue>3</issue>
          <fpage>198</fpage>
          <lpage>204</lpage>
        <pub-id pub-id-type="doi">10.1264/jsme2.me10194</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848204788">
        <label>39.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Johnson</surname>
            <given-names>T J</given-names>
          </name>
          <name>
            <surname>Wannemuehler</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Doetkott</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Johnson</surname>
            <given-names>S J</given-names>
          </name>
          <name>
            <surname>Rosenberger</surname>
            <given-names>S C</given-names>
          </name>
          <name>
            <surname>Nolan</surname>
            <given-names>L K</given-names>
          </name>
          <article-title>Identification of minimal predictors of avian pathogenic Escherichia coli virulence for use as a rapid diagnostic tool</article-title>
          <date>
            <year>2008</year>
          </date>
          <source>J Clin Microb</source>
          <volume>46</volume>
          <fpage>3987</fpage>
          <lpage>3996</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848200252">
        <label>40.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>M</surname>
            <given-names>J Schwaber</given-names>
          </name>
          <name>
            <surname>Carmeli</surname>
            <given-names>Y</given-names>
          </name>
          <article-title>Carbapenem-resistant Enterobacteriaceae: a potential threat</article-title>
          <date>
            <year>2008</year>
          </date>
          <source>Jama</source>
          <volume>300</volume>
          <issue>24</issue>
          <fpage>2911</fpage>
          <lpage>2913</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848196436">
        <label>41.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Nordmann</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Naas</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>Poirel</surname>
            <given-names>L</given-names>
          </name>
          <article-title>Global spread of carbapenemase-producing Enterobacteriaceae. Emerging infectious diseases</article-title>
          <date>
            <year>2011</year>
          </date>
          <volume>17</volume>
          <issue>10</issue>
          <fpage>1791</fpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848192620">
        <label>42.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>WHO</surname>
            <given-names/>
          </name>
          <article-title>Health Organization), “Critically important antimicrobials list. 5th rev,”</article-title>
          <date>
            <year>2017</year>
          </date>
          <fpage>http://who.int/foodsafety/publications/antimicrobials-fifth/en/.</fpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848189740">
        <label>43.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Fang</surname>
            <given-names>D O N G</given-names>
          </name>
          <name>
            <surname>L</surname>
            <given-names>U Jie</given-names>
          </name>
          <name>
            <surname>Yan</surname>
            <given-names>W A N G</given-names>
          </name>
          <name>
            <surname>Jin</surname>
            <given-names>S H I</given-names>
          </name>
          <name>
            <surname>J</surname>
            <given-names>H Zhen</given-names>
          </name>
          <name>
            <surname>Ping</surname>
            <given-names>C H U</given-names>
          </name>
          <article-title>A five-year surveillance of carbapenemase-producing Klebsiella pneumoniae in a pediatric hospital in China reveals increased predominance of NDM-1. Biomedical and environmental sciences</article-title>
          <date>
            <year>2017</year>
          </date>
          <volume>30</volume>
          <issue>8</issue>
          <fpage>562</fpage>
          <lpage>569</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848186716">
        <label>44.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>K</surname>
            <given-names/>
          </name>
          <name>
            <surname>M</surname>
            <given-names>A Toleman</given-names>
          </name>
          <name>
            <surname>T</surname>
            <given-names>R Walsh</given-names>
          </name>
          <name>
            <surname>Bagaria</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Butt</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>Balakrishnan</surname>
            <given-names>R</given-names>
          </name>
          <article-title>Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study. The Lancet infectious diseases</article-title>
          <date>
            <year>2010</year>
          </date>
          <volume>10</volume>
          <issue>9</issue>
          <fpage>597</fpage>
          <lpage>602</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848183692">
        <label>45.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>W</surname>
            <given-names>J Liang</given-names>
          </name>
          <name>
            <surname>Liu</surname>
            <given-names>43Ahmed</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Shimamoto</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>Shimamoto</surname>
            <given-names>T</given-names>
          </name>
          <article-title>Molecular characterization of multidrug-resistant avian pathogenic Escherichia coli isolated from septicemic broilers</article-title>
          <date>
            <year>2013</year>
          </date>
          <source>International Journal of Medical Microbiology</source>
          <fpage>303</fpage>
          <lpage>8</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848142116">
        <label>46.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Yong</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>A Toleman</given-names>
          </name>
          <name>
            <surname>C</surname>
            <given-names>G Giske</given-names>
          </name>
          <name>
            <surname>H</surname>
            <given-names>S Cho</given-names>
          </name>
          <name>
            <surname>Sundman</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Lee</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>T</surname>
            <given-names>R Walsh</given-names>
          </name>
          <article-title>Characterization of a new metallo-β-lactamase gene, bla NDM-1, and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrobial agents and chemotherapy</article-title>
          <date>
            <year>2009</year>
          </date>
          <volume>53</volume>
          <issue>12</issue>
          <fpage>5046</fpage>
          <lpage>5054</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848137436">
        <label>47.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>T</surname>
            <given-names>R Walsh</given-names>
          </name>
          <article-title>Emerging carbapenemases: a global perspective</article-title>
          <date>
            <year>2010</year>
          </date>
          <source>International journal of antimicrobial agents</source>
          <volume>36</volume>
          <fpage>S8</fpage>
          <lpage>S14</lpage>
        <pub-id pub-id-type="doi">10.1016/s0924-8579(10)70004-2</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848135852">
        <label>48.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>D</surname>
            <given-names>M Livermore</given-names>
          </name>
          <article-title>Has the era of untreatable infections arrived?</article-title>
          <date>
            <year>2009</year>
          </date>
          <source>Journal of Antimicrobial Chemotherapy</source>
          <volume>64</volume>
          <fpage>i29</fpage>
          <lpage>i36</lpage>
        <pub-id pub-id-type="doi">10.1093/jac/dkp255</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848132396">
        <label>49.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Ahmad</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Khattak</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>Ali</surname>
            <given-names>A</given-names>
          </name>
          <article-title>Carbapenemases and extended-spectrum β-lactamase–producing multidrug-resistant Escherichia coli isolated from retail chicken in Peshawar: first report from Pakistan,”</article-title>
          <date>
            <year>2018</year>
          </date>
          <source>Journal of Food Protection</source>
          <volume>81</volume>
          <fpage>1339</fpage>
          <lpage>1345</lpage>
        <pub-id pub-id-type="doi">10.4315/0362-028x.jfp-18-045</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848129012">
        <label>50.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Poirel</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Berçot</surname>
            <given-names>B</given-names>
          </name>
          <name>
            <surname>Millemann</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>R</surname>
            <given-names>A Bonnin</given-names>
          </name>
          <name>
            <surname>Pannaux</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>Nordmann</surname>
            <given-names>P</given-names>
          </name>
          <article-title>Carbapenemase-producing Acinetobacter spp. in cattle</article-title>
          <date>
            <year>2012</year>
          </date>
          <source>France,” Emerging Infectious Diseases</source>
          <volume>18</volume>
          <fpage>523</fpage>
          <lpage>525</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848126924">
        <label>51.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>P</surname>
            <given-names>L Ho</given-names>
          </name>
          <name>
            <surname>Y</surname>
            <given-names/>
          </name>
          <name>
            <surname>Wang</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>W</surname>
            <given-names>U Lo</given-names>
          </name>
          <name>
            <surname>Lai</surname>
            <given-names>E L Y</given-names>
          </name>
          <name>
            <surname>K</surname>
            <given-names>H Chow</given-names>
          </name>
          <name>
            <surname>Cheng</surname>
            <given-names>V C C</given-names>
          </name>
          <article-title>Characterization of carbapenem-resistant Escherichia coli and Klebsiella pneumoniae from a healthcare region in Hong Kong</article-title>
          <date>
            <year>2016</year>
          </date>
          <source>European Journal of Clinical Microbiology &amp; Infectious Diseases</source>
          <volume>35</volume>
          <fpage>379</fpage>
          <lpage>385</lpage>
        <pub-id pub-id-type="doi">10.1007/s10096-015-2550-3</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848121956">
        <label>52.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Tian</surname>
            <given-names>X</given-names>
          </name>
          <name>
            <surname>Zheng</surname>
            <given-names>X</given-names>
          </name>
          <name>
            <surname>Sun</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Fang</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Zhang</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Zhang</surname>
            <given-names>X</given-names>
          </name>
          <article-title>Molecular mechanisms and epidemiology of carbapenem-resistant Escherichia coli isolated from Chinese patients during 2002–2017. Infection and Drug Resistance</article-title>
          <date>
            <year>2020</year>
          </date>
          <fpage>501</fpage>
          <lpage>512</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1848117348">
        <label>53.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Gülmez</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Woodford</surname>
            <given-names>N</given-names>
          </name>
          <name>
            <surname>Palepou</surname>
            <given-names>M F I</given-names>
          </name>
          <name>
            <surname>Mushtaq</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Metan</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>Yakupogullari</surname>
            <given-names>Y</given-names>
          </name>
          <article-title>Carbapenem-resistant Escherichia coli and Klebsiella pneumoniae isolates from Turkey with OXA-48-like carbapenemases and outer membrane protein loss</article-title><source>International journal of antimicrobial agents</source><date>
            <year>2008</year>
          </date>
          <volume>31</volume>
          <issue>6</issue>
          <fpage>523</fpage>
          <lpage>526</lpage>
        <pub-id pub-id-type="doi">10.1016/j.ijantimicag.2008.01.017</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848147948">
        <label>54.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>V</surname>
            <given-names>C Cheng</given-names>
          </name>
          <name>
            <surname>S</surname>
            <given-names>C Wong</given-names>
          </name>
          <name>
            <surname>P</surname>
            <given-names>L Ho</given-names>
          </name>
          <name>
            <surname>K</surname>
            <given-names>Y Yuen</given-names>
          </name>
          <article-title>Strategic measures for the control of surging antimicrobial resistance in Hong Kong and mainland of China. Emerging microbes &amp; infections</article-title>
          <date>
            <year>2015</year>
          </date>
          <fpage>4</fpage>
          <lpage>1</lpage>
        <pub-id pub-id-type="doi">10.1038/emi.2015.8</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848144564">
        <label>55.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>P</surname>
            <given-names>L Ho</given-names>
          </name>
          <name>
            <surname>Chu</surname>
            <given-names>Y P S</given-names>
          </name>
          <name>
            <surname>W</surname>
            <given-names>U Lo</given-names>
          </name>
          <name>
            <surname>K</surname>
            <given-names>H Chow</given-names>
          </name>
          <name>
            <surname>P</surname>
            <given-names>Y Law</given-names>
          </name>
          <name>
            <surname>Tse</surname>
            <given-names>C W S</given-names>
          </name>
          <article-title>High prevalence of Escherichia coli sequence type 131 among antimicrobial-resistant E. coli isolates from geriatric patients</article-title>
          <date>
            <year>2015</year>
          </date>
          <source>Journal of Medical Microbiology</source>
          <volume>64</volume>
          <issue>3</issue>
          <fpage>243</fpage>
          <lpage>247</lpage>
        <pub-id pub-id-type="doi">10.1099/jmm.0.000012</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1848090372">
        <label>56.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Cheng</surname>
            <given-names>V C C</given-names>
          </name>
          <name>
            <surname>Chan</surname>
            <given-names>J F W</given-names>
          </name>
          <name>
            <surname>Wong</surname>
            <given-names>S C Y</given-names>
          </name>
          <name>
            <surname>Chen</surname>
            <given-names>J H K</given-names>
          </name>
          <name>
            <surname>Tai</surname>
            <given-names>J W M</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>K Yan</given-names>
          </name>
          <name>
            <surname>Kwan</surname>
            <given-names>G S W</given-names>
          </name>
          <article-title>Proactive infection control measures to prevent nosocomial transmission of carbapenem-resistant Enterobacteriaceae in a non-endemic area</article-title>
          <date>
            <year>2013</year>
          </date>
          <source>Chinese Medical Journal</source>
          <volume>126</volume>
          <issue>23</issue>
          <fpage>4504</fpage>
          <lpage>450</lpage>
        <pub-id pub-id-type="doi">10.3760/cma.j.issn.0366-6999.20130741</pub-id></mixed-citation>
      </ref>
    </ref-list>
  </back>
</article>